Advertisement

FAM13A is a modifier gene of cystic fibrosis lung phenotype regulating rhoa activity, actin cytoskeleton dynamics and epithelial-mesenchymal transition

Open AccessPublished:November 24, 2017DOI:https://doi.org/10.1016/j.jcf.2017.11.003

      Abstract

      Background

      Cystic fibrosis (CF) lung disease severity is highly variable and dependent on several factors including genetic modifiers. Family with sequence similarity 13 member A (FAM13A) has been previously associated with lung function in the general population as well as in several chronic lung diseases, such as chronic obstructive pulmonary disease (COPD), we examined whether FAM13A is a modifier gene of CF lung phenotype. We also studied how FAM13A may contribute to the physiopathological mechanisms associated with CF.

      Methods

      We investigated the association of FAM13A with lung function in CF French patients (n = 1222) by SNP-wise analysis and Versatile Gene Based Association Study. We also analyzed the consequences of FAM13A knockdown in A549 cells and primary bronchial epithelial cells from CF patients.

      Results

      We found that FAM13A is associated with lung function in CF patients. Utilizing lung epithelial A549 cells and primary human bronchial epithelial cells from CF patients we observed that IL-1β and TGFβ reduced FAM13A expression. Knockdown of FAM13A was associated with increased RhoA activity, induction of F-actin stress fibers and regulation of epithelial-mesenchymal transition markers such as E-cadherin, α-smooth muscle actin and vimentin.

      Conclusion

      Our data show that FAM13A is a modifier gene of CF lung phenotype regulating RhoA activity, actin cytoskeleton dynamics and epithelial-mesenchymal transition.

      Abbreviations:

      CF (Cystic fibrosis), FAM13A (Family with sequence similarity 13 member A), COPD (Chronic obstructive pulmonary diseases), CFTR (CF transmembrane conductance regulator), GAP (GTPase activating protein), VEGAS (Versatile Gene Based Association Study), EMT (epithelial to mesenchymal transition), KNoRMA (Kulich normalized mortality adjusted CF-specific lung phenotype), hAECBs (human airway epithelial cells from bronchi), MAF (minor allele frequency), FEV1 (forced expiratory volume in 1s), siFAM13 (siRNA for FAM13A), siCTRL (siRNA negative control)

      Keywords

      1. Introduction

      Cystic fibrosis (CF) is a monogenic disease caused by mutations in the CF transmembrane conductance regulator (CFTR) gene. However, lung disease severity is highly variable and dependent of several factors including genetic modifiers [
      • Guillot L.
      • Beucher J.
      • Tabary O.
      • Le Rouzic P.
      • Clement A.
      • Corvol H.
      Lung disease modifier genes in cystic fibrosis.
      ,
      • Weiler C.A.
      • Drumm M.L.
      Genetic influences on cystic fibrosis lung disease severity.
      ]. The modifier genes are indeed thought to contribute to approximately 50% of the lung phenotype in CF patients harboring the common CFTR F508del mutation [
      • Cutting G.R.
      Modifier genes in Mendelian disorders: the example of cystic fibrosis.
      ]. Family with sequence similarity 13 member A (FAM13A) has been previously shown to be associated with the lung function in the general population [
      • Hancock D.B.
      • Eijgelsheim M.
      • Wilk J.B.
      • Gharib S.A.
      • Loehr L.R.
      • Marciante K.D.
      • et al.
      Meta-analyses of genome-wide association studies identify multiple loci associated with pulmonary function.
      ] as well as in patients with asthma, COPD, idiopathic pulmonary fibrosis and lung cancer [
      • Cho M.H.
      • Boutaoui N.
      • Klanderman B.J.
      • Sylvia J.S.
      • Ziniti J.P.
      • Hersh C.P.
      • et al.
      Variants in FAM13A are associated with chronic obstructive pulmonary disease.
      ,
      • Fingerlin T.E.
      • Murphy E.
      • Zhang W.
      • Peljto A.L.
      • Brown K.K.
      • Steele M.P.
      • et al.
      Genome-wide association study identifies multiple susceptibility loci for pulmonary fibrosis.
      ,
      • Guo Y.
      • Lin H.
      • Gao K.
      • Xu H.
      • Deng X.
      • Zhang Q.
      • et al.
      Genetic analysis of IREB2, FAM13A and XRCC5 variants in Chinese Han patients with chronic obstructive pulmonary disease.
      ,
      • Pillai S.G.
      • Kong X.
      • Edwards L.D.
      • Cho M.H.
      • Anderson W.H.
      • Coxson H.O.
      • et al.
      Loci identified by genome-wide association studies influence different disease-related phenotypes in chronic obstructive pulmonary disease.
      ,
      • Young R.P.
      • Hopkins R.J.
      • Hay B.A.
      • Whittington C.F.
      • Epton M.J.
      • Gamble G.D.
      FAM13A locus in COPD is independently associated with lung cancer - evidence of a molecular genetic link between COPD and lung cancer.
      ,
      • Corvol H.
      • Hodges C.A.
      • Drumm M.L.
      • Guillot L.
      Moving beyond genetics: is FAM13A a major biological contributor in lung physiology and chronic lung diseases?.
      ]. The protein sequence of FAM13A contains a rho GTPase activating protein (GAP) domain. GAPs inactivate GTPases by the conversion of GTP to GDP. GTPases are known to play a role in the actin cytoskeleton and remodeling as they regulate assembly of focal adhesions and F-actin stress fibers [
      • Nusrat A.
      • Giry M.
      • Turner J.R.
      • Colgan S.P.
      • Parkos C.A.
      • Carnes D.
      • et al.
      Rho protein regulates tight junctions and perijunctional actin organization in polarized epithelia.
      ]. Therefore, variants affecting the on/off switch of this GTPase feedback loop via the FAM13A-GAP domain may modify disease progression possibly by dysregulating Rho signaling and disrupting the cytoskeleton. The most common rho GTPases include RhoA, RhoB, RhoC, Rac1 and Cdc42. Perturbed rho GTPase signaling is associated with several lung diseases, including asthma, pulmonary hypertension, chronic obstructive pulmonary disease (COPD), and lung cancer [
      • Duluc L.
      • Wojciak-Stothard B.
      Rho GTPases in the regulation of pulmonary vascular barrier function.
      ]. In chronic lung diseases, RhoA is the most commonly associated GTPase for changes in the barrier function and actin cytoskeleton. Interestingly, RhoA has been reported to be upregulated in CF cells [
      • Kreiselmeier N.E.
      • Kraynack N.C.
      • Corey D.A.
      • Kelley T.J.
      Statin-mediated correction of STAT1 signaling and inducible nitric oxide synthase expression in cystic fibrosis epithelial cells.
      ].
      To date, no study has explored the role of FAM13A as a potential candidate for modifying the CF lung phenotype. In this study, we investigated whether FAM13A variants associated with CF lung phenotype. Considering the numerous publications involving FAM13A in lung disease progression, susceptibility and severity, and the potential role of the rhoGAP domain, we also examined the function of FAM13A in the lung and how it could participate in the CF lung physiopathology.

      2. Materials and methods

      2.1 Patients and lung phenotype

      The French CF Gene Modifier Consortium has been recently described [
      • Corvol H.
      • Blackman S.M.
      • Boelle P.Y.
      • Gallins P.J.
      • Pace R.G.
      • Stonebraker J.R.
      • et al.
      Genome-wide association meta-analysis identifies five modifier loci of lung disease severity in cystic fibrosis.
      ]. Characteristics of 1222 French patients included in this study are shown in Table 1. Written informed consent was obtained from adults. For patients < 18 years old consent from parents or guardians was given for participation in the study. The study was approved by the French ethical committee (CPP n°2004/15) and the information collection was approved by CNIL (n°04.404).
      Table 1Characteristics of CF patients enrolled in FAM13A genotyping.
      Cohort
      n1222
      Mean age (±SD)21.0 (9.2)
      Range6.0–57.6
      Male n (%)627 (51.3)
      European
      On the basis of Eigenstrat principal components analysis and closeness to CEU.
      n (%)
      1211 (99.1)
      F508del/F508del n (%)716 (58.6)
      Pancreatic exocrine insufficient n (%)1222 (100.0)
      a On the basis of Eigenstrat principal components analysis and closeness to CEU.
      We transformed forced expiratory volume in 1 s (FEV1) to the Kulich normalized mortality adjusted CF-specific lung phenotype (KNoRMA) [
      • Taylor C.
      • Commander C.W.
      • Collaco J.M.
      • Strug L.J.
      • Li W.
      • Wright F.A.
      • et al.
      A novel lung disease phenotype adjusted for mortality attrition for cystic fibrosis genetic modifier studies.
      ], a standardized consortium lung phenotype which allows for direct comparison of the lung function of CF patients irrespective of age and gender.

      2.2 Reagents

      Lipopolysaccharide (LPS, Pseudomonas aeruginosa 10), anti-FAM13A (HPA038109) and anti-β-actin antibodies were from Sigma-Aldrich (Saint-Quentin Fallavier, France) and TNF-alpha (TNF-α) and IL-1-beta (IL-1β) were from Immunotools (Friesoythe, Germany). Transforming Growth Factor-beta (TGF-β) was from PeproTech (Rocky Hill, NJ, USA). Anti-E-cadherin, anti-vimentin, anti-rabbit and anti-mouse-Horseradish peroxidase (HRP) antibodies were from Cell Signaling Technology (Danvers, MA, USA). Anti-RhoA antibody and rhotekin-RBD beads are from cytoskeleton (Denver, USA). Rhosin (Rho inhibitor) was from Millipore (Billirica, MA, USA). FAM13A expression (p.FAM13A) and control plasmids (p.CTRL) were from Origene (RC216561, Rockville, MD, USA). Silencer® Select siRNA for FAM13A (siFAM13) and negative control (siCTRL) were from Ambion (Austin, TX, USA). Lipofectamine 3000 was from invitrogen (Carlsbad, CA, USA).

      2.3 Cell cultures

      We used two types of respiratory epithelial cells: A549 (Alveolar origin; ATCC®-CCL185, Rockville, MD, USA), and commercial primary human airway epithelial cells from bronchi (hAECBs, Epithelix, Geneva, Switzerland) (Table 2). A549 cells were cultured as previously described [
      • Guillot L.
      • Medjane S.
      • Le-Barillec K.
      • Balloy V.
      • Danel C.
      • Chignard M.
      • et al.
      Response of human pulmonary epithelial cells to lipopolysaccharide involves toll-like receptor 4 (TLR4)-dependent signaling pathways: evidence for an intracellular compartmentalization of TLR4.
      ] then seeded in plates (TPP, Techno Plastic Products, Trasadingen, Switzerland) as described in the figure legends. A549 cells were stimulated for 6 h with LPS, TNF-α 10 ng/mL, or IL-1β 10 ng/mL. For TGF-β experiments, A549 cells were serum starved for 6 h and then treated with 5 ng/mL of TGF-β for 24 h (mRNA quantification) or 48 h (protein expression) as indicated in the figure legends. Primary hAECBs were isolated from the bronchi of healthy individuals or CF patients and were cultured as recommended by the manufacturer.
      Table 2Characteristics of primary cells used in the study.
      Patient numberCommercial referenceAge (years)SexSmokerPathologyCFTR mutationUsed in experiments
      P1AB03780163MNoNoNoFig. 5A
      P2AB02010267FNoNoNoFig. 5A
      P3AB005350FNoNoNoFig. 5A
      P4AB5310173FNoNoNoFig. 5A
      P5AB6000156FNoNoNoFig. 5A
      P6AB5390137MNoNoNoFigs. 2B, 5A
      P7CF2200229FNoCFF508delFig. 5A, Supplemantary Fig. 2A
      P8CF4370227MNoCFF508delFig. 5A, B(lower panel), Supplementary Fig. 2A
      P9CF4450225FNoCFF508delFig. 5A
      P10CF6090121FNoCFF508delFig. 5A, Supplementary Fig. 2A
      P11CF5670139FNoCFF508delFig. 5A, C, Supplementary Fig. 2A–D
      P12CF4370327MNoCFF508delFigs. 2B, 5A, B(upper panel), C–D, Supplementary Fig. 2A
      P13CF6070121FNoCFF508delFig. 5C

      2.4 RT-qPCR

      Total RNA was extracted using a nucleospin extract II kit (Macherey Nagel, Duren, Germany). Reverse transcription (RT) was performed using the ABI high-capacity cDNA kit (Applied Biosystems, Foster City, CA). Real-time PCR was performed using an ABI StepOnePlus™. Each reaction contained 10 μL of 2× TaqMan® Fast Universal PCR Master Mix (Applied Biosystems), 0,5 μL of FAM13A (For5′ACCCTGTTTGAAGTAGAGTATACAG3′/Rev5′AGACCTCTTTTACTATGATAAGCCT3′/probe: 5′TCTGAGATGTGAAAACCTGGCT3′), E-Cadherin (Hs01023894_m1), Alpha SMA (Hs00426835_g1), Vimentin (Hs00958111_m), GAPDH (Hs03929097_g1) or HPRT1 (Hs02800695_m1) Taqman® probe, and cDNA as the template in a final volume of 10 μL. For relative quantification, the amount of target genes was normalized to GAPDH or HPRT1 (housekeeping genes) as indicated in figure legends relative to control cells used as the calibrator and was calculated using the 2−ΔΔCt method [
      • Flamein F.
      • Riffault L.
      • Muselet-Charlier C.
      • Pernelle J.
      • Feldmann D.
      • Jonard L.
      • et al.
      Molecular and cellular characteristics of ABCA3 mutations associated with diffuse parenchymal lung diseases in children.
      ]. Each point corresponds to the mean ± SD of N experiments as indicated in the figure legends.

      2.5 Immunohistochemistry

      Human lung biopsy is from a 53 years old woman with lung cancer and was obtained from Hôpital Foch, Suresnes 92150, France. It was collected in a healthy zone of the lung and processed in compliance with the current French public health legislation (articles L.1235-2 and L.1245-2, code de la santé publique, www.legifrance.gouv.fr). The institution informed the patient and made sure that they were not opposed to the use of surgical samples for research purposes. The staining procedure was realized with 5-μm thick paraffin sections. Immunolabeling for FAM13A was performed on a Bond-III® automat (Leica, Leica Biosystems, Nussloch, Germany) using anti-FAM13A antibody (1/400).

      2.6 Western-blot

      An equal amount of protein from each sample was size-separated on 10% SDS-polyacrylamide gel and electrotransferred to a nitrocellulose membrane using iblot system (Invitrogen). Immunodetection was performed with specific antibodies followed by secondary-HRP antibodies. Bound antibodies were detected using SuperSignal West Femto chemiluminescent substrate (Thermo Scientific, Rockford, IL, USA) according to the manufacturer's instructions. Between successive probes, membranes were treated with Restore Western Blot Stripping reagent (Thermo Scientific). Molecular masses were determined using the PageRuler Plus Pre-Stained Standard (Thermoscientific). Images were recorded with a Fujifilm LAS-3000 bioimaging system (Fujifilm, Stamford, CT, USA).

      2.7 Fluorescence microscopy

      2.7.1 F-actin staining

      A549 and hAECBs were plated in 35-mm Petri dishes (iBidi, Martinsried, Germany) and 8-well μslide dishes (iBidi) respectively. Cells were fixed with ice cold PFA 4% 10 min, rinsed three times with PBS, permeabilized with PBS-0.1% Triton X-100, blocked with PBS-5% BSA, and the stained for 30 min with Alexa-594 or Alexa-488 phalloidin (Molecular probes). DAPI (Sigma-Aldrich) was used to stain the nucleus.

      2.7.2 FAM13A staining

      Cells were plated in 8-well μslide dishes (iBidi) fixed with ice cold PFA 4% 10 min in growth medium supplemented with 10% FCS. The cells were permeabilized 3 × 5 min with 0.1% Triton X-100 in PBS; and then, washed with PBS and incubated overnight at 4 °C with anti-FAM13A (1/100) in PBS supplemented with 4% FCS. The following day, the cells were washed 3 × 10 min with PBS and incubated for 1 h at room temperature with anti-rabbit Alexa fluor®-488 (Molecular probes, Eugene, OR, USA). Fluorescence microscopy was achieved using a Zeiss Axiovert 200 microscope with a 63× oil objective (Zeiss, Le Pecq, France).

      2.8 ELISA

      Concentrations of human TGF-β were measured in cell culture supernatants according to the manufacturer's instructions (Duoset, R&D Systems, Minneapolis, MN, USA). The 3,3′,5,5′-tetramethylbenzidine (TMB) substrate was from Cell Signaling Technology (Danvers, MA, USA).

      2.9 RhoA pull-down assay

      RhoA and total RhoA expressions were measured using a RhoA activation assay kit (cytoskeleton, denver, OH, USA). Briefly, A549 in 60 mm dishes were transfected with siRNA CTRL (166 pmol), siRNA FAM13A (166 pmol) or the FAM13A expression plasmid (8 μg) for 48 h using lipofectamine 3000. Protein extracts (400 μg) were incubated 2 h with 40 μL of GST-rhotekin beads, washed, suspended in Laemli buffer (2×), boiled 3 min and subjected to SDS-PAGE. For total RhoA expression, 40 μg of total protein was used. Activated/total RhoA was detected using an anti-RhoA antibody (Cytoskeleton). The membrane of total RhoA was stripped and reprobed by anti-actin antibody. RhoA activity semi-quantification was determined by using Image J (http://imagej.nih.gov/ij/) and expressed as the ratio between RhoA/total RhoA. Total RhoA activity was determined relative to β-actin expression.

      2.10 Statistical analysis

      Genomic information was imputed using 1000 genomes as described previously [
      • Corvol H.
      • Blackman S.M.
      • Boelle P.Y.
      • Gallins P.J.
      • Pace R.G.
      • Stonebraker J.R.
      • et al.
      Genome-wide association meta-analysis identifies five modifier loci of lung disease severity in cystic fibrosis.
      ]. Principal component analysis (eigenstrat) indicated no population substructure. The KNorMA values were analyzed according to number of minor alleles at each locus (additive model). We tested phenotype/genotype associations SNP-wise and gene-wise using the Versatile Gene-based Association Study (VEGAS) sum statistic (v2) [
      • Mishra A.
      • Macgregor S.
      VEGAS2: software for more flexible gene-based testing.
      ]. All SNPS with a minor allele frequency (MAF) > 0.02 (as chosen previously [
      • Soave D.
      • Corvol H.
      • Panjwani N.
      • Gong J.
      • Li W.
      • Boelle P.Y.
      • et al.
      A joint location-scale test improves power to detect associated SNPs, gene sets, and pathways.
      ]) within the gene and at <20 kb of the gene boundaries were included. Individual SNPs p-values were adjusted with the Bonferroni rule. Gene boundaries coordinates were obtained from NCBI (GRCh37). p-Values were computed by permutations.
      For in vitro experiments, differences among groups were assessed for statistical significance using Prism 6.00 software (GraphPad Software, La Jolla, CA, USA). Mann-Whitney and Wilcoxon test were used for comparison of two groups. For >2 groups, ANOVA was used with Bonferonni or Dunnet's correction. A p value < 0.05 was taken to indicate statistical significance.

      3. Results

      3.1 FAM13A is associated with lung disease severity in CF patients

      In the GWAS, 1283 SNPs within the FAM13A gene with MAF > 0.02 had been genotyped and/or imputed [
      • Corvol H.
      • Blackman S.M.
      • Boelle P.Y.
      • Gallins P.J.
      • Pace R.G.
      • Stonebraker J.R.
      • et al.
      Genome-wide association meta-analysis identifies five modifier loci of lung disease severity in cystic fibrosis.
      ]. Overall, FAM13A was associated with lung phenotype in CF patients (VEGAS sum test, p < 0.017). The most associated SNP was rs7682431 (unadjusted p-value p = 5,28 × 10−5, Bonferroni adjusted p-value p = 0.068, Fig. 1A), the GG genotype being found in those with the most impaired lung function (Fig. 1B). The 254 SNPs showing association (unadjusted p-value p < 0.05) with changes in lung phenotype are reported in Supplementary Table 1. Previous variants shown to be associated with COPD [
      • Cho M.H.
      • Boutaoui N.
      • Klanderman B.J.
      • Sylvia J.S.
      • Ziniti J.P.
      • Hersh C.P.
      • et al.
      Variants in FAM13A are associated with chronic obstructive pulmonary disease.
      ] (rs1903003, rs7671167, rs2869967) were found to be in strong linkage disequilibrium (rs1903003/rs7682431: D′ = 0.92; rs7671167/rs7682431: D′ = 0.909; rs2869967/rs7682431: 0.93) and to be associated in CF with the same direction (Supplementary Table 1: rs1903003 (MAF: 0.5, p < 0.003, β = −0.09), rs7671167 (MAF: 0,54, p < 0.0006, β = −0.1), rs2869967 (MAF: 0.36, p < 0.004, β = 0.09)).

      3.2 FAM13A is expressed in lung epithelial cells

      In order to understand how FAM13A might contribute to the lung phenotype, we aimed to characterize its biological function. Firstly, we assessed FAM13A protein expression level in A549 cells. We observed that FAM13A was expressed in A549 cells with an expected molecular weight of ~117 kDa that was reduced with a siRNA against FAM13A (Fig. 2A ).
      Fig. 1
      Fig. 1FAM13A variants are associated with lung phenotype in CF patients. (A) LocusZoom plot of the association evidence (build GRCh37, LocusZoom viewer) in CF individuals in the FAM13A region with significant associated SNPs with FEV1 in SNP-Wise analysis. Colours represent 1000 Genomes CEU linkage disequilibrium r2 values with each SNP (p values are in column three of Supplementary Table 1). The purple diamond is the most significant SNP rs7682431. Genes within the region are shown in the lower panel, and the unbroken blue line indicates the recombination rate within the region. (B) Median survival Adjusted CF specific FEV1 Z-score on the genotype obtained for rs7682431 in the studied poupulation.
      Fig. 2
      Fig. 2Expression and localization of FAM13A in respiratory epithelium. (A) Western blot analysis of FAM13A and β-actin (loading control) expression in A549 cells seeded in 6-well plates at 3 × 105 cells and incubated 48 h with 75 pmol of a siRNA control (siRNA CTRL), or a siRNA targeting FAM13A. (B) Immunostaining of FAM13A (green) in A549 and hAECBs from WT (P7) and CF (P13) donors analyzed by fluorescence microscopy. DAPI (blue) was used to stain the nucleus. Scale bars corresponds to 10 μm. Secondary antibody was used as a control (−). (C) Immunohistology staining of FAM13A of lung tissue sections from human (upper panel: ×20, scale bars: 20 μm; lower panel: dotted rectangle, ×60, scale bars: 10 μm). Secondary antibody was used as a control (−).
      Efficiency of the antibody and specificity of this band was addressed using an expression plasmid for FAM13A (Supplementary Fig. 1A). Also, the maximal reduction of FAM13A expression was observed 48 h after the siRNA transfection, resulting in 60% reduction of the transcript and 90% reduction of the protein respectively (Supplementary Fig. 1B–C). Immunofluorescence analysis showed a cytoplasmic perinuclear expression in A549 and in primary bronchial cells from control or CF patients (Fig. 2B). Additionally, using sections from human lungs, we confirmed that FAM13A staining was positive in bronchial cells (Fig. 2C).

      3.3 FAM13A expression is reduced in the inflammatory context

      We studied the regulation of FAM13A in an inflammatory context in order to mimic some of the lung physiopathological characteristics of CF. Stimulation of A549 cells with IL-1β resulted in a 50% reduction of FAM13A mRNA and protein levels (Fig. 3A ). TNFα also tended to decrease FAM13A expression, but without reaching significance, and LPS had no effect. As expected from previous studies [
      • Lie P.P.
      • Cheng C.Y.
      • Mruk D.D.
      The biology of interleukin-1: emerging concepts in the regulation of the actin cytoskeleton and cell junction dynamics.
      ], we verified that IL-1β affected the epithelial characteristics of the cells by looking at the E-cadherin marker. This marker, normally expressed in epithelial cells at the cell membrane adhering junctions, plays a key role in cell polarity and links to the actin network [
      • Baum B.
      • Georgiou M.
      Dynamics of adherens junctions in epithelial establishment, maintenance, and remodeling.
      ]. A concomitant significant reduction in both FAM13A and E-cadherin expressions was seen with IL-1β (Fig. 3A, right panel).
      Fig. 3
      Fig. 3FAM13A expression is downregulated by IL-1β in A549 cells and its knockdown induces F-actin stress fibers and increase RhoA activity. (A) FAM13A mRNA relative expression was assessed by qPCR in A549 cells seeded at 2 × 105 cells in 12-well plates and stimulated 6 h with LPS from P. aeruginosa (1 μg/mL), TNF-α (20 ng/mL), IL-1β (10 ng/mL) (Left panel). The statistical analysis consisted in ANOVA followed by Dunnett's multiple comparison test (unstimulated group (−) used as the control group) **p < 0.01. Data are representative of the mean ± SEM of eight experiments realized in duplicate. Western blot of FAM13A, E-cadherin (E-CAD) and β-actin (loading control) in A549 stimulated with IL-1β (10 ng/mL) for 6 h. A representative experiment displayed in triplicate is shown and quantified (Right panel). The statistical analysis consisted in Mann-Whitney test (− vs. IL-1β group) *p < 0.05. (B) Western blot of RhoA total RhoA, β-actin (loading control) after RhoA GST-Pull down in cells transfected with siCTRL, siFAM13A, pFAM13A and pCTRL (left panel). Quantification of RhoA activity expressed in arbitruary unit (a.u) (right panel). The statistical analysis consisted in Mann-Whitney test (siCTRL vs. siFAM13A group; pCTRL vs. pFAM13A group). Data are representative of the mean ± SEM four independent experiments. *p < 0.05. (C) A549 cells transfected with siCTRL (left panel) or siFAM13A (right panel) for 48 h were further treated for 1 h with rhosin or its solvent DMSO. Cells were incubated with Alexa 488-phalloidin to observe F-actin staining. Scale bars corresponds to 10 μm. (D) Western blot of FAM13A, E-cadherin and β-actin (loading control) in A549 cells transfected with siCTRL or siFAM13A for 48 h. Quantification of protein expression is in arbitruary unit (a.u) The statistical analysis consisted in Mann-Whitney test. *p < 0.05, *p < 0.001.

      3.4 FAM13A regulates the actin dynamics via RhoA

      In order to assess the cellular functions of FAM13A, its expression was decreased with a targeted siRNA. We observed that the transient reduced expression of FAM13A resulted in an increased RhoA activation (Fig. 3B). In contrast, overexpression of FAM13A led to a reduced RhoA activity (Fig. 3B). We showed that FAM13A loss by siRNA (48 h) resulted in F-actin cytoskeleton changes with the induction of stress fibers, loss of cell-cell contacts, and sparsely located cells (Fig. 3C). This effect is not observed when cells are incubated with rho inhibitor rhosin. The reduction of E-cadherin at the protein level with concomitant decreased FAM13A expression by siRNA was confirmed (Fig. 3D). Altogether, these data confirmed the role of FAM13A as a rhoGAP and RhoA as a downstream target of FAM13A. In addition, FAM13A reduction promoted changes in the epithelial cytoskeleton by loss of E-cadherin.
      Fig. 4
      Fig. 4FAM13A knockdown promotes E-cadherin loss and vimentin increase expressions induced by TGF-β in A549 cells. (A) FAM13A, E-cadherin, αSMA and vimentin mRNA relative quantification (HPRT used as the housekeeping gene) by qPCR of A549 seeded at 2 × 105 cells/well in 12-well plates and transfected with 30 pmol of siCTRL or siFAM13A for 24 h and then stimulated with 5 ng/mL TGF-β for 24 h. Data are representative of the mean ± SEM of four experiments realized in triplicate. The statistical analysis consisted in ANOVA followed by Bonferroni's multiple comparison test (siCTRL vs. siCTRL + TGF-β; siCTRL vs. FAM13A; siCTRL + TGF-β vs. siFAM13A + TGF-β; siFAM13A vs. siFAM13A + TGF-β). *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. (B) Western-blot of E-cadherin and vimentin expression of A549 transfected with 30 pmol of siCTRL or siFAM13A for 24 h and then stimulated with 5 ng/mL TGF-β for 48 h. Quantification of E-cadherin and vimentin expression in arbitrary unit (a.u) in three independent experiments. Data are representative of the mean ± SEM of three independent experiments. The statistical analysis consisted in ANOVA followed by Bonferroni's multiple comparison test (siCTRL vs. siCTRL + TGF-β; siCTRL vs. FAM13A; siFAM13A vs. siFAM13A + TGF-β). **p < 0.01. (C) Alexa-488 phalloidin staining A549 transfected with siCTRL or siFAM13A for 24 h and stimulated with 5 ng/mL TGF-β for 48 h was analyzed by fluorescence microscopy.
      Fig. 5
      Fig. 5FAM13A is downregulated by IL-1β in primary hAECBs from WT and CF patients and its knockdown induces F-actin stress fibers. (A) FAM13A mRNA expression by qPCR of primary hAECBs from 6 control donors (WT, P1 to P6) and 6 CF patients (P7 to P12) stimulated for 6 h with 10 ng/mL of IL-1β. Data are representative of the mean ± SEM of six independent experiments (each one including a WT and a CF patient's sample). The statistical analysis consisted in Wilcoxon test. *p < 0.05 (WT (−) vs. WT (IL-1), WT (−) vs. CF (−); #p < 0.05 (CF (−) vs. CF (IL-1)); §p < 0.05 (CF (IL-1) vs. WT (IL-1)). (B) Primary hAECBs from CF patients seeded at 3 × 105 cells/well in 6 well-plates were transfected with 75 pmol of siCTRL or siFAM13A for 48 h and stained for FAM13A (upper panel, P13) or F-actin (lower panel, P9). (C) Western-blot of E-CAD, vimentin and β-actin (loading control) expression of CF hAECBs (Patient 1: P12, Patient 2: P11, Patient 3: P13) transfected with 75 pmol of siCTRL or siFAM13A for 24 h and then stimulated with 5 ng/mL TGF-β for 48 h. (D) Primary hAECBs from a CF patient (P12) seeded at 5 × 104 cell/well in ibidi-8well μslide were transfected with 3 pmol of siCTRL or siFAM13A for 24 h and then stimulated for 48 h by 5 ng/mL TGF-β. Cells were stained with Alexa-594 phalloidin (red) and DAPI (Blue) was used to stain the nucleus. Scale bars corresponds to 10 μm.

      3.5 Role of FAM13A in TGFβ-induced EMT

      As TGF-β is known to affect changes in Rho signaling [
      • Bhowmick N.A.
      • Ghiassi M.
      • Bakin A.
      • Aakre M.
      • Lundquist C.A.
      • Engel M.E.
      • et al.
      Transforming growth factor-beta1 mediates epithelial to mesenchymal transdifferentiation through a RhoA-dependent mechanism.
      ] and to promote epithelial to mesenchymal transition (EMT) [
      • Kasai H.
      • Allen J.T.
      • Mason R.M.
      • Kamimura T.
      • Zhang Z.
      TGF-beta1 induces human alveolar epithelial to mesenchymal cell transition (EMT).
      ], we studied the impact of FAM13A reduction in EMT induced by TGF-β. Several markers for EMT were examined, including E-cadherin, α-smooth muscle actin (α-SMA) and vimentin. In EMT, these markers have an inverse expression profile with E-cadherin being reduced and α-SMA and vimentin increased. The qPCR analyses showed that treatments with either siRNA-FAM13A or TGF-β, resulted in 60% and 20% reduction of FAM13A at the transcriptional level respectively (Fig. 4A). This effect of TGFβ is dose and time dependant (Supplementary Fig. 1D). Treatment with siFAM13A resulted in a slight but significant decrease of expression of E-cadherin (Fig. 4A). This pattern was also observed at the protein level but without reaching statistical significance (Fig. 4B). As expected, TGF-β strongly decreased E-cadherin and induced α-SMA and vimentin. The combination of both TGF-β and siFAM13A for 24 h led to a highly significant increase in α-SMA and vimentin mRNA (Fig. 4A). This increased vimentin expression was confirmed by western blot (Fig. 4B). These effects were not due to endogenous increases in TGF-β secretion in cells with knockdown of FAM13A by siRNA, as the ELISA demonstrated no significant change in TGF-β release in siCTRL and siFAM13A treated cells (not illustrated). In addition, phalloidin staining showed that the combination of the knockdown of FAM13A with TGF-β resulted in more severe changes of the F-actin cytoskeleton than TGF-β alone (Fig. 4C).

      3.6 Changes in FAM13A expression and cytoskeleton in primary bronchial epithelial cells

      Using primary hAECBs, we observed that CF cells had a lower FAM13A expression level compared to WT cells (Fig. 5A). We also confirmed the inhibitory effect of IL-1β on FAM13A mRNA expression with a significant reduction of 20% in both WT and F508del cells (Fig. 5A). However, this inhibition was modest compared to the 50% decrease seen in A549 cells (Fig. 2A). The silencing of FAM13A by siRNA for 48 h in hAECBs was efficient at the mRNA (Supplementary Fig. 2A) and protein levels as shown by immunofluorescence staining (Fig. 5B, upper panel) and was associated with changes in the F-actin cytoskeleton (Fig. 5B, lower panel). We observed that TGF-β is able to reduce FAM13A (Supplementary Fig. 2B) and regulate the expression of the EMT markers. Indeed, we detected by qPCR a reduction of E-cadherin and an increase of vimentin in a time and concentration dependent manner (Supplementary Fig. 2C and D respectively). By western blot, we observed in hAECBs from three independent CF patients, that the loss of FAM13A by siRNA (72 h) was associated with a slight decreased E-Cadherin expression but had no effect on vimentin expression (Fig. 5C). However, the stimulation by TGF-β of hAECBs knockdown for FAM13A promoted the increase of vimentin expression. Consistent with the western blot, the inhibition of FAM13A by siRNA resulted in changes in the F-actin cytoskeleton with the induction of stress fibers (Fig. 5D), which is exacerbated with TGF-β, suggestive of a more pronounced EMT phenotype. Altogether, these results suggested that as in the A549 cells, the loss of FAM13A in primary CF cells led to cytoskeletal changes and promoted EMT.

      4. Discussion

      In this study, we show that FAM13A is a modifier gene of CF lung phenotype. Also, in airway epithelial cells FAM13A modulation regulates RhoA activity, actin cytoskeleton dynamics and EMT. Using SNP-based analysis in a large and well-phenotyped CF cohort, we show that FAM13A variants associate with lung disease severity in CF patients with rs7682431 being the most significant associated SNP. FAM13A was originally associated with lung function in the general population [
      • Hancock D.B.
      • Eijgelsheim M.
      • Wilk J.B.
      • Gharib S.A.
      • Loehr L.R.
      • Marciante K.D.
      • et al.
      Meta-analyses of genome-wide association studies identify multiple loci associated with pulmonary function.
      ]. Moreover, large genetic studies have also suggested the involvement of FAM13A in the onset and progression of other chronic lung diseases such as COPD [
      • Cho M.H.
      • Boutaoui N.
      • Klanderman B.J.
      • Sylvia J.S.
      • Ziniti J.P.
      • Hersh C.P.
      • et al.
      Variants in FAM13A are associated with chronic obstructive pulmonary disease.
      ,
      • Corvol H.
      • Hodges C.A.
      • Drumm M.L.
      • Guillot L.
      Moving beyond genetics: is FAM13A a major biological contributor in lung physiology and chronic lung diseases?.
      ]. Interestingly, very little is known about the role of FAM13A in the lung. Since we found that FAM13A was associated with the CF lung function phenotype, we then aimed to understand its role in lung epithelial cells especially in the inflammatory context relevant for CF. The most significant FAM13A variants identified across the several genetic studies, including ours, were not predicted to be damaging by classical bioinformatics analysis and were located in region for which functional tests were barely feasible. Therefore, we decided to study the function of the entire FAM13A gene in the inflammatory context relevant for CF.
      First, we assessed the expression of FAM13A in human lung epithelial cells. FAM13A protein is detected at the molecular weight of 117 kDa and a siRNA directed against FAM13A is able to reduce its expression. We observed by immunofluorescence that endogenous FAM13A was expressed in A549 and primary hAECBs and localized in the cytoplasm with a perinuclear staining. These results were consistent with a recent study looking at exogenous FAM13A in overexpression experiments in 16HBE cells [
      • Jiang Z.
      • Lao T.
      • Qiu W.
      • Polverino F.
      • Gupta K.
      • Guo F.
      • et al.
      A chronic obstructive pulmonary disease susceptibility gene, FAM13A, regulates protein stability of beta-catenin.
      ]. In A549 cells using the same antibody, FAM13A was also previously detected by western blot predominantly in the cytoplasm and faintly in the nucleus [
      • Jin Z.
      • Chung J.W.
      • Mei W.
      • Strack S.
      • He C.
      • Lau G.W.
      • et al.
      Regulation of nuclear-cytoplasmic shuttling and function of family with sequence similarity 13, member A (Fam13a), by B56-containing PP2As and Akt.
      ]. Immunostaining of lung sections from human detected FAM13A in bronchial cells, which was consistent with recent observations in mice [
      • Jiang Z.
      • Lao T.
      • Qiu W.
      • Polverino F.
      • Gupta K.
      • Guo F.
      • et al.
      A chronic obstructive pulmonary disease susceptibility gene, FAM13A, regulates protein stability of beta-catenin.
      ] and human tissues [
      • Miller S.
      • Melen E.
      • Merid S.K.
      • Hall I.P.
      • Sayers I.
      Genes associated with polymorphic variants predicting lung function are differentially expressed during human lung development.
      ].
      CF is characterized by an excessive inflammatory response of the airways. Therefore, we evaluated the modulation of FAM13A expression by inflammatory molecules relevant in the CF physiopathology such as LPS from Pseudomonas aeruginosa, TNF-α and IL-1β. Indeed, these cytokines are both detected in sputum of CF patients and are known to activate rhoA and induce F-actin stress fibers [
      • Lie P.P.
      • Cheng C.Y.
      • Mruk D.D.
      The biology of interleukin-1: emerging concepts in the regulation of the actin cytoskeleton and cell junction dynamics.
      ,
      • Mathew S.J.
      • Haubert D.
      • Kronke M.
      • Leptin M.
      Looking beyond death: a morphogenetic role for the TNF signalling pathway.
      ]. We observed that the expression of FAM13A was indeed reduced in A549 cells stimulated by IL-1β but not modified by LPS and TNF-α. The expression of the epithelial marker E-cadherin was also downregulated by IL-1β, as previously shown in BEAS2-B cells [
      • Doerner A.M.
      • Zuraw B.L.
      TGF-beta1 induced epithelial to mesenchymal transition (EMT) in human bronchial epithelial cells is enhanced by IL-1beta but not abrogated by corticosteroids.
      ], another lung epithelial cell line, which suggested some changes in cell plasticity. We confirmed this effect in primary hAECBs from both WT and CF donors. This reduction reached only 20%, but was likely relevant considering the chronic exposure of the epithelium to IL-1β in CF. Interestingly, at baseline, CF cells expressed less FAM13A which may explain the overexpression of RhoA already demonstrated in human [
      • Vandivier R.W.
      • Richens T.R.
      • Horstmann S.A.
      • deCathelineau A.M.
      • Ghosh M.
      • Reynolds S.D.
      • et al.
      Dysfunctional cystic fibrosis transmembrane conductance regulator inhibits phagocytosis of apoptotic cells with proinflammatory consequences.
      ] and mouse [
      • Kreiselmeier N.E.
      • Kraynack N.C.
      • Corey D.A.
      • Kelley T.J.
      Statin-mediated correction of STAT1 signaling and inducible nitric oxide synthase expression in cystic fibrosis epithelial cells.
      ] CF cells in comparison to WT cells. However, this result may be biased by the age difference of the two groups of cell donors, the CF patients being younger. In a previous study comparing nasal epithelial cells from control and CF patients, FAM13A overexpression was observed in CF samples by microarray analysis (Supplementary data, fold change not available) [
      • Wright J.M.
      • Merlo C.A.
      • Reynolds J.B.
      • Zei'tlin P.L.
      • Garcia J.G.
      • Guggino W.B.
      • et al.
      Respiratory epithelial gene expression in patients with mild and severe cystic fibrosis lung disease.
      ]. This contrasting result may be explained by the type of cells used in this study. In fact, in CF transcriptomic profiles between nasal and bronchial cells are known to be different [
      • Ogilvie V.
      • Passmore M.
      • Hyndman L.
      • Jones L.
      • Stevenson B.
      • Wilson A.
      • et al.
      Differential global gene expression in cystic fibrosis nasal and bronchial epithelium.
      ]. Clinical characteristics of the patients such as their treaments may also explain this discrepancy.
      In CF, IL-1β is known to be produced in high amounts [
      • Sagel S.D.
      • Wagner B.D.
      • Anthony M.M.
      • Emmett P.
      • Zemanick E.T.
      Sputum biomarkers of inflammation and lung function decline in children with cystic fibrosis.
      ] and we have shown here that IL-1β induced a reduction of FAM13A expression. Thus, we evaluated the cellular consequences of a downregulation of FAM13A by loss of function experiments using a siRNA. The association of RhoGTPases with changes in the actin cytoskeleton is well described. Also, IL-1β has been shown to increase RhoA activity and induce actin stress fibers [
      • Ganter M.T.
      • Roux J.
      • Miyazawa B.
      • Howard M.
      • Frank J.A.
      • Su G.
      • et al.
      Interleukin-1beta causes acute lung injury via alphavbeta5 and alphavbeta6 integrin-dependent mechanisms.
      ]. Thus, we assessed if the knockdown of FAM13A could regulate RhoA activity and how this relates to changes in the actin cytoskeleton. As expected, we observed that the knockdown of FAM13A which harbor a rhoGAP domain, increased RhoA activity whereas FAM13A overexpression decreased its activity. Interestingly, previous publications found RhoA expression to be upregulated in both CFTR knockout cells and in CFTR knockout mice [
      • Kreiselmeier N.E.
      • Kraynack N.C.
      • Corey D.A.
      • Kelley T.J.
      Statin-mediated correction of STAT1 signaling and inducible nitric oxide synthase expression in cystic fibrosis epithelial cells.
      ,
      • Vandivier R.W.
      • Richens T.R.
      • Horstmann S.A.
      • deCathelineau A.M.
      • Ghosh M.
      • Reynolds S.D.
      • et al.
      Dysfunctional cystic fibrosis transmembrane conductance regulator inhibits phagocytosis of apoptotic cells with proinflammatory consequences.
      ]. Active RhoA plays an important role in recycling wildtype CFTR to the plasma membrane via the Na+/H+-exchanger regulatory factor isoform-1 (NHERF1). However constitutively activated RhoA does not promote recycling of F508del-CFTR to the plasma membrane, indicating that reduction of FAM13A could facilitate maintenance of F508del-CFTR in the degradative/lysosomal pathway [
      • Farinha C.M.
      • Matos P.
      • Amaral M.D.
      Control of cystic fibrosis transmembrane conductance regulator membrane trafficking: not just from the endoplasmic reticulum to the Golgi.
      ]. We showed here that loss of FAM13A was markedly associated with changes in the actin cytoskeleton and changes in cell-to-cell adhesion both in A549 cells and in primary hAECBs both from CTRL and CF patients. The attenuated effect seen in hAECBs may be linked to the different origin (immortalized alveolar vs. bronchial) and type (cell line vs. primary) of cells. Interestingly, it has been shown that severe actin cytoskeleton rearrangement inhibits cAMP mediated activation of CFTR [
      • Cantiello H.F.
      Role of actin filament organization in CFTR activation.
      ]. Further studies are thus needed to understand if FAM13A has a direct impact on CFTR traffic and function.
      TGF-β is the most commonly associated profibrotic cytokine and its role in promoting EMT or to a myofibroblast phenotype has been well documented. In CF, TGF-β has been shown to be upregulated in the plasma of CF patients [
      • Harris W.T.
      • Muhlebach M.S.
      • Oster R.A.
      • Knowles M.R.
      • Clancy J.P.
      • Noah T.L.
      Plasma TGF-beta(1) in pediatric cystic fibrosis: potential biomarker of lung disease and response to therapy.
      ], and several TGFB1 polymorphisms have been associated with an increased lung disease severity [
      • Dorfman R.
      • Sandford A.
      • Taylor C.
      • Huang B.
      • Frangolias D.
      • Wang Y.
      • et al.
      Complex two-gene modulation of lung disease severity in children with cystic fibrosis.
      ]. In our study, the loss of FAM13A in epithelial cells demonstrated similar changes in the actin cytoskeletal network as those seen with TGF-β in previous publications [
      • Bhowmick N.A.
      • Ghiassi M.
      • Bakin A.
      • Aakre M.
      • Lundquist C.A.
      • Engel M.E.
      • et al.
      Transforming growth factor-beta1 mediates epithelial to mesenchymal transdifferentiation through a RhoA-dependent mechanism.
      ]. Considering the knockdown of FAM13A by IL1-β, we examined whether TGF-β may also affect FAM13A expression. We observed that TGF-β was also able to downregulate FAM13A expression, which provided some evidence that FAM13A may play a role in the intersection of the inflammatory signaling pathways of IL-1β, RhoA and TGF-β. This result confirms a recent study involving the role of FAM13A in non-small cell lung cancer progression showing a downregulation of FAM13A by TGF-β in A549 cells [
      • Eisenhut F.
      • Heim L.
      • Trump S.
      • Mittler S.
      • Sopel N.
      • Andreev K.
      • et al.
      FAM13A is associated with non-small cell lung cancer (NSCLC) progression and controls tumor cell proliferation and survival.
      ]. Knockdown of FAM13A alone also promoted a downregulation of E-cadherin but no upregulation of αSMA and vimentin, indicative markers of loss of epithelial phenotype and the potential change to a mesenchymal phenotype via EMT. When FAM13A was silenced, TGF-β promoted this phenotype by further decreasing E-Cadherin and increasing αSMA and vimentin expressions. E-cadherin is located at cell-cell junctions and is reduced in cells where the epithelial layer integrity disintegrates; particularly with TGF-β. TGF-β driven loss of epithelial characteristics and gain of mesenchymal markers occurs through RhoA [
      • Bhowmick N.A.
      • Ghiassi M.
      • Bakin A.
      • Aakre M.
      • Lundquist C.A.
      • Engel M.E.
      • et al.
      Transforming growth factor-beta1 mediates epithelial to mesenchymal transdifferentiation through a RhoA-dependent mechanism.
      ]. Even if a role for EMT in CF has been suggested in a transcriptomic study [
      • Clarke L.A.
      • Botelho H.M.
      • Sousa L.
      • Falcao A.O.
      • Amaral M.D.
      Transcriptome meta-analysis reveals common differential and global gene expression profiles in cystic fibrosis and other respiratory disorders and identifies CFTR regulators.
      ], no evidence of EMT has been shown in CF and further studies are needed. Indeed, in vivo evidence of EMT in chronic lung disease such as COPD is still controversial [
      • Bartis D.
      • Mise N.
      • Mahida R.Y.
      • Eickelberg O.
      • Thickett D.R.
      Epithelial-mesenchymal transition in lung development and disease: does it exist and is it important?.
      ].
      The full impact of FAM13A in CF lung disease is still to be resolved. Loss of epithelial integrity is associated with fibrosis [
      • Pain M.
      • Bermudez O.
      • Lacoste P.
      • Royer P.J.
      • Botturi K.
      • Tissot A.
      • et al.
      Tissue remodelling in chronic bronchial diseases: from the epithelial to mesenchymal phenotype.
      ], and reduction of FAM13A, either through a genetic polymorphism, or increased IL1-β and TGF-β with inflammation, appears to promote loss of epithelial integrity by altered RhoA signaling. In CF, loss of epithelial integrity promotes invasion and internalization of P. aeruginosa by airway epithelial [
      • Plotkowski M.C.
      • de Bentzmann S.
      • Pereira S.H.
      • Zahm J.M.
      • Bajolet-Laudinat O.
      • Roger P.
      • et al.
      Pseudomonas aeruginosa internalization by human epithelial respiratory cells depends on cell differentiation, polarity, and junctional complex integrity.
      ]. Also, loss of RhoA-associated epithelial integrity was shown to promote the susceptibility of airway epithelial cells to Staphylococcus aureus [
      • Soong G.
      • Martin F.J.
      • Chun J.
      • Cohen T.S.
      • Ahn D.S.
      • Prince A.
      Staphylococcus aureus protein A mediates invasion across airway epithelial cells through activation of RhoA GTPase signaling and proteolytic activity.
      ]. Finally, actin cytoskeleton organization has been shown to impact CFTR activation [
      • Cantiello H.F.
      Role of actin filament organization in CFTR activation.
      ]. In this context, another rhoGTPases, cdc42 was recently shown to impact CFTR stability [
      • Ferru-Clement R.
      • Fresquet F.
      • Norez C.
      • Metaye T.
      • Becq F.
      • Kitzis A.
      • et al.
      Involvement of the Cdc42 pathway in CFTR post-translational turnover and in its plasma membrane stability in airway epithelial cells.
      ].
      Several genetic studies have found FAM13A associated with the lung function in different chronic lung diseases [
      • Corvol H.
      • Hodges C.A.
      • Drumm M.L.
      • Guillot L.
      Moving beyond genetics: is FAM13A a major biological contributor in lung physiology and chronic lung diseases?.
      ], as well as with airway obstruction in general [
      • van der Plaat D.A.
      • de Jong K.
      • Lahousse L.
      • Faiz A.
      • Vonk J.M.
      • van Diemen C.C.
      • et al.
      Genome-wide association study on the FEV1/FVC ratio in never-smokers identifies HHIP and FAM13A.
      ]. FAM13A functional studies are thus needed and will help to decipher if common or different physiopathological mechanisms are involved among these different diseases. A recent study in COPD patients showed that FAM13A may influence COPD susceptibility by promoting β-catenin degradation. An increase of FAM13A expression and a concomitant decrease β-catenin downregulation was observed in comparison with healthy ex-smokers. In this study, Fam13A−/− mice were resistant to chronic cigarette smoke induced emphysema [
      • Jiang Z.
      • Lao T.
      • Qiu W.
      • Polverino F.
      • Gupta K.
      • Guo F.
      • et al.
      A chronic obstructive pulmonary disease susceptibility gene, FAM13A, regulates protein stability of beta-catenin.
      ]. Previous publications have shown that CFTR influences the Wnt/β-catenin signaling in lung development [
      • Cohen J.C.
      • Larson J.E.
      • Killeen E.
      • Love D.
      • Takemaru K.
      CFTR and Wnt/beta-catenin signaling in lung development.
      ] and emerging data showed that a defective CFTR/β-catenin interaction promoted intestinal inflammation in the mouse model [
      • Liu K.
      • Zhang X.
      • Zhang J.T.
      • Tsang L.L.
      • Jiang X.
      • Chan H.C.
      Defective CFTR- beta-catenin interaction promotes NF-kappaB nuclear translocation and intestinal inflammation in cystic fibrosis.
      ]. All these results suggest that in chronic lung diseases FAM13A is at the intersection of tissue remodeling pathways that include wnt/β-catenin, EMT and TGF-β.
      We showed that FAM13A is a modifier gene of the lung phenotype in CF patients. We identified the localization of FAM13A in both the alveolar A549 cell line, as well as in human primary bronchial cells, confirming the presence of FAM13A in lung epithelial cells. We also demonstrated the rhoGAP function of FAM13A and that knockdown of FAM13A constitutively activates RhoA. Additionally, the regulation of FAM13A by IL1-β and TGF-β was determined. These findings offer insight into the complex inflammatory milieu that promotes disease severity in CF.
      • Supplementary Table 1

        List of FAM13A SNPs associated with the lung function in CF patients. SNPs with their chromosomic location (BP) and Minor allele frequencies (MAF) are classified from the lowest to the highest p value.

      Supplementary Fig. 1
      Supplementary Fig. 1Validation of FAM13A antibody, siRNA and TGF-β time-dose response in A549 cells. (A) Western blot analysis of FAM13A expression in A549 cells transfected with 0, 0.5 and 1 μg of plasmid encoding FAM13A (RC216561) using an anti-FAM13A antibody. (B) FAM13A mRNA expression by qPCR in A549 cells transfected with siCTRL or siFAM13A for 48 h. Data are representative of three experiments realized in triplicate. The statistical analysis consisted in Mann-Whitney test (siCTRL group vs. siFAM13A group). *p < 0.05. (C) FAM13A and E-cadherin protein expression by western-blot, in A549 cells transfected with siCTRL or siFAM13A for 24 h and 48 h. (D) FAM13A mRNA expression in A549 cells stimulated with increasing dose of TGF-β (2, 5, 10 ng/mL) and time (24 h, 48 h, 72 h). The dashed line represent the time chosen in the other experiments of the study.
      Supplementary Fig. 2
      Supplementary Fig. 2Validation of FAM13A siRNA and TGF-β time and dose response in hAECBs. (A) FAM13A mRNA in hAECBs-F508del transfected with siCTRL or siFAM13A for 48 h. Data are representative of the mean ± SEM of six different CF donors. The statistical analysis consisted in Wilcoxon test (siCTRL group vs. siFAM13A group). *p < 0.05. (B) FAM13A, (C) Vimentin and (D) E-cadherin mRNAs in hAECBs-F508del from one CF patient stimulated with increasing dose of TGF-β (2, 5, 10 ng/mL) and time (24 h, 48 h, 72 h). The dashed line represent the time chosen in the other experiments of the study.

      Acknowledgements

      LG received a grant from the French cystic-fibrosis non-profit organization Vaincre la mucoviscidose , a Legs Poix grant from the publicly funded source Chancellerie des Universités de Paris . KT received a post-doctoral fellowship from the French cystic-fibrosis non-profit organization Vaincre la mucoviscidose. HC received a grant from the French cystic-fibrosis non-profit organizations Vaincre la mucoviscidose and Agir et Informer Contre la Mucoviscidose (AICM) and a grant from the Cystic Fibrosis Foundation ( CORVOL16G0 ). We thank the patients, care providers and clinic coordinators at CF Centers.

      Contributing French CF centers and principal investigators

      ABELY, M., American Memorial Hospital, Reims/ALBERTINI, M., Hôpital Lenval, Nice/BASSINET, L., Centre Hospitalier Intercommunal de Créteil, Créteil/BELLEGUIC, C., Hôpital Pontchaillou, Rennes/BELLON, G., Hôpital Femme Mère Enfant, Bron/BESSACI, K., American Memorial Hospital, Reims/BILLON, Y., Hôpital de Brabois, Vandoeuvre les Nancy/BONNEL, A.S., Hôpital André Mignot, Le Chesnay/BRÉMONT, F., Hôpital des Enfants de Toulouse, Toulouse/BROUARD, J., Centre Hospitalier Universitaire de Caen, Caen/BUI, S., Hôpital Des Enfants Groupe Pellegrin, Bordeaux/CAMARA, B., Hôpital de la Tronche, Grenoble/CAMPBELL, K., Centre Hospitalier Universitaire de Caen, Caen/CHIRON, R., Hôpital Arnaud de Villeneuve, Montpellier/CHUMBI-FLORES, R., Hôpital de la Tronche, Grenoble/CLEMENT, A., Hôpital Armand Trousseau, Paris/CORVOL, H., Hôpital Armand Trousseau, Paris/DALPHIN, J.C., CNRS-UFC,UMR 6249 Chrono-environnement, Hôpital Jean Minjoz, Besançon/DALPHIN, M.L., Centre Hospitalier Universitaire de Besançon, Besançon/DAVID, V., Hôpital Mère-Enfant, Nantes/DE MIRANDA, S., Hôpital Foch, Suresnes/DENEUVILLE, É., Hôpital Sud Annexe Pédiatrique, Rennes/DERELLE, J., Hôpital d'Enfants, Vandoeuvre les Nancy/DOMBLIDES, P., Hôpital Haut Lévêque, Pessac/DOMINIQUE, S., Centre Hospitalier Universitaire Charles Nicolle, Rouen/DUBUS, J.C., Hôpital d'Enfants de la Timone, Marseille/DURIEU, I., UCBL1,Groupe Hospitalier Lyon Sud - Hospices Civils de Lyon, Pierre Bénite/DURY, S., Hôpital Maison Blanche, Reims/ELLAFFI, M., Centre Hospitalier Universitaire de Caen, Caen/EPAUD, R., Centre Hospitalier Intercommunal de Créteil, Créteil/FANTON, A., Hôpital d'Enfants du Bocage, Dijon/FAYON, M., Hôpital Des Enfants Groupe Pellegrin, Bordeaux/FLEURENCE, E., Hôpital d'Enfants, Saint-Denis de la Réunion/FOUCAUD, P., Hôpital André Mignot, Le Chesnay/GINIES, J.L., Centre Hospitalier Universitaire d'Angers, Angers/GODBERT, B., Hôpital de Brabois, Vandoeuvre les Nancy/GRENET, D., Hôpital Foch, Suresnes/GUILLOT, M., Centre Hospitalier Robert Bisson, Lisieux/HÉRAUD, M. C., Centre Hospitalier Estaing, Clermont-Ferrand/HOUSSET, B., Centre Hospitalier Intercommunal de Créteil, Créteil/HUBERT, D., Hôpital Cochin, Paris/HUET, F., Hôpital d'Enfants du Bocage, Dijon/KESSLER, R., Hôpital Civil, Strasbourg/LABBÉ, A., Centre Hospitalier Estaing, Clermont-Ferrand/LAURANS, M., Centre Hospitalier Universitaire de Caen, Caen/LE BOURGEOIS, M., Necker Hôpital d'Enfants Malades, Paris/LE ROUX, P., Hôpital Jacques Monod, Montivilliers/LEROY, S., Hôpital Pasteur, Nice/LLERENA, C., Hôpital de la Tronche, Grenoble/LOEUILLE, G.A., Centre Hospitalier de Dunkerque, Dunkerque/MARGUET, C., Centre Hospitalier Universitaire Charles Nicolle, Rouen/MELY, L., Hôpital Renée Sabran, Giens/MOISAN-PETIT, V., Centre Hospitalier Bretagne Atlantique, Vannes/MUNCK, A., Hôpital Robert Debré, Paris/MURRIS-ESPIN, M., Hôpital Larrey, Toulouse/NOVE JOSSERAND, R., Groupe Hospitalier Lyon Sud - Hospices Civils de Lyon, Pierre Bénite/PAUTARD, J.C., Hôpital Nord, Amiens/PICCINI-BAILLY, C., Hôpital Lenval, Nice/PIN, I., INSERM U823 Université Joseph Fourier, Hôpital de la Tronche, Grenoble/PRAMIL, S., Centre Hospitalier Universitaire Charles Nicolle, Rouen/PREVOTAT, A., Hôpital Calmette, Lille/RAMES, C., Hôpital Nord, Amiens/RAULT, G., Centre de Perharidy, Roscoff/REIX, P., Hôpital Femme Mère Enfant, Bron/REMUS, N., Centre Hospitalier Intercommunal de Créteil, Créteil/RENOUIL, M., Groupe Hospitalier Sud Réunion, Saint-Pierre de la Réunion/REYNAUD-GAUBERT, M., Hôpital Nord, Marseille/RICHAUD THIRIEZ, B., Hôpital Jean Minjoz, Besançon/ROUSSEY, M., Université de Rennes 1, Hôpital Sud Annexe Pédiatrique, Rennes/SERMET-GAUDELUS, I., Necker Hôpital d'Enfants Malades, Paris/STORNI, V., Centre Hospitalier Bretagne Atlantique, Vannes/STREMLER, N., Hôpital d'Enfants de la Timone, Marseille/UFFREDI, M.L., Centre Hospitalier Bretagne Atlantique, Vannes/URBAN, T., Centre Hospitalier Universitaire d'Angers, Angers/VIGNERON, P., Centre Hospitalier Bretagne Sud, Lorient/WALLAERT, B., Hôpital Calmette, Lille/WEISS, L., Hôpital de Hautepierre, Strasbourg/WIZLA, N., Hôpital Jeanne de Flandre, Lille.

      Conflict of interest statement

      The authors declare that they have no conflict of interest.

      References

        • Guillot L.
        • Beucher J.
        • Tabary O.
        • Le Rouzic P.
        • Clement A.
        • Corvol H.
        Lung disease modifier genes in cystic fibrosis.
        Int J Biochem Cell Biol. 2014; 52 ([PubMed PMID: 24569122]): 83-93https://doi.org/10.1016/j.biocel.2014.02.011
        • Weiler C.A.
        • Drumm M.L.
        Genetic influences on cystic fibrosis lung disease severity.
        Front Pharmacol. 2013; 4 ([PubMed PMID: 23630497; PubMed Central PMCID: PMCPMC3632778]): 40https://doi.org/10.3389/fphar.2013.00040
        • Cutting G.R.
        Modifier genes in Mendelian disorders: the example of cystic fibrosis.
        Ann N Y Acad Sci. 2010; 1214 ([PubMed PMID: 21175684; PubMed Central PMCID: PMCPMC3040597]): 57-69https://doi.org/10.1111/j.1749-6632.2010.05879.x
        • Hancock D.B.
        • Eijgelsheim M.
        • Wilk J.B.
        • Gharib S.A.
        • Loehr L.R.
        • Marciante K.D.
        • et al.
        Meta-analyses of genome-wide association studies identify multiple loci associated with pulmonary function.
        Nat Genet. 2010; 42 ([PubMed PMID: 20010835; PubMed Central PMCID: PMCPMC2832852]): 45-52https://doi.org/10.1038/ng.500
        • Cho M.H.
        • Boutaoui N.
        • Klanderman B.J.
        • Sylvia J.S.
        • Ziniti J.P.
        • Hersh C.P.
        • et al.
        Variants in FAM13A are associated with chronic obstructive pulmonary disease.
        Nat Genet. 2010; 42 ([PubMed PMID: 20173748; PubMed Central PMCID: PMCPMC2828499]): 200-202https://doi.org/10.1038/ng.535
        • Fingerlin T.E.
        • Murphy E.
        • Zhang W.
        • Peljto A.L.
        • Brown K.K.
        • Steele M.P.
        • et al.
        Genome-wide association study identifies multiple susceptibility loci for pulmonary fibrosis.
        Nat Genet. 2013; 45 ([PubMed PMID: 20173748; PubMed Central PMCID: PMCPMC2828499]): 613-620https://doi.org/10.1038/ng.2609
        • Guo Y.
        • Lin H.
        • Gao K.
        • Xu H.
        • Deng X.
        • Zhang Q.
        • et al.
        Genetic analysis of IREB2, FAM13A and XRCC5 variants in Chinese Han patients with chronic obstructive pulmonary disease.
        Biochem Biophys Res Commun. 2011; 415 ([PubMed PMID: 22027142]): 284-287https://doi.org/10.1016/j.bbrc.2011.10.042
        • Pillai S.G.
        • Kong X.
        • Edwards L.D.
        • Cho M.H.
        • Anderson W.H.
        • Coxson H.O.
        • et al.
        Loci identified by genome-wide association studies influence different disease-related phenotypes in chronic obstructive pulmonary disease.
        Am J Respir Crit Care Med. 2010; 182 ([PubMed PMID: 20656943; PubMed Central PMCID: PMCPMC3029936]): 1498-1505https://doi.org/10.1164/rccm.201002-0151OC
        • Young R.P.
        • Hopkins R.J.
        • Hay B.A.
        • Whittington C.F.
        • Epton M.J.
        • Gamble G.D.
        FAM13A locus in COPD is independently associated with lung cancer - evidence of a molecular genetic link between COPD and lung cancer.
        Appl Clin Genet. 2011; 4 ([PubMed PMID: 23776362; PubMed Central PMCID: PMCPMC3681173]): 1-10https://doi.org/10.2147/TACG.S15758
        • Corvol H.
        • Hodges C.A.
        • Drumm M.L.
        • Guillot L.
        Moving beyond genetics: is FAM13A a major biological contributor in lung physiology and chronic lung diseases?.
        J Med Genet. 2014; 51 ([PubMed PMID: 25163686]): 646-649https://doi.org/10.1136/jmedgenet-2014-102525
        • Nusrat A.
        • Giry M.
        • Turner J.R.
        • Colgan S.P.
        • Parkos C.A.
        • Carnes D.
        • et al.
        Rho protein regulates tight junctions and perijunctional actin organization in polarized epithelia.
        Proc Natl Acad Sci U S A. 1995; 92 ([PubMed PMID: 7479854; PubMed Central PMCID: PMCPMC40665]): 10629-10633
        • Duluc L.
        • Wojciak-Stothard B.
        Rho GTPases in the regulation of pulmonary vascular barrier function.
        Cell Tissue Res. 2014; 355 ([PubMed PMID: 24599334]): 675-685https://doi.org/10.1007/s00441-014-1805-0
        • Kreiselmeier N.E.
        • Kraynack N.C.
        • Corey D.A.
        • Kelley T.J.
        Statin-mediated correction of STAT1 signaling and inducible nitric oxide synthase expression in cystic fibrosis epithelial cells.
        Am J Phys Lung Cell Mol Phys. 2003; 285 ([PubMed PMID: 12948935]): L1286-95https://doi.org/10.1152/ajplung.00127.2003
        • Corvol H.
        • Blackman S.M.
        • Boelle P.Y.
        • Gallins P.J.
        • Pace R.G.
        • Stonebraker J.R.
        • et al.
        Genome-wide association meta-analysis identifies five modifier loci of lung disease severity in cystic fibrosis.
        Nat Commun. 2015; 6 ([PubMed PMID: 26417704; PubMed Central PMCID: PMCPMC4589222]): 8382https://doi.org/10.1038/ncomms9382
        • Taylor C.
        • Commander C.W.
        • Collaco J.M.
        • Strug L.J.
        • Li W.
        • Wright F.A.
        • et al.
        A novel lung disease phenotype adjusted for mortality attrition for cystic fibrosis genetic modifier studies.
        Pediatr Pulmonol. 2011; 46 ([PubMed PMID: 21462361; PubMed Central PMCID: PMCPMC3130075]): 857-869https://doi.org/10.1002/ppul.21456
        • Guillot L.
        • Medjane S.
        • Le-Barillec K.
        • Balloy V.
        • Danel C.
        • Chignard M.
        • et al.
        Response of human pulmonary epithelial cells to lipopolysaccharide involves toll-like receptor 4 (TLR4)-dependent signaling pathways: evidence for an intracellular compartmentalization of TLR4.
        J Biol Chem. 2004; 279 ([PubMed PMID: 14600154]): 2712-2718https://doi.org/10.1074/jbc.M305790200
        • Flamein F.
        • Riffault L.
        • Muselet-Charlier C.
        • Pernelle J.
        • Feldmann D.
        • Jonard L.
        • et al.
        Molecular and cellular characteristics of ABCA3 mutations associated with diffuse parenchymal lung diseases in children.
        Hum Mol Genet. 2012; 21 ([PubMed PMID: 22068586; PubMed Central PMCID: PMCPMC3263986]): 765-775https://doi.org/10.1093/hmg/ddr508
        • Mishra A.
        • Macgregor S.
        VEGAS2: software for more flexible gene-based testing.
        Twin Res Hum Genet. 2015; 18 ([PubMed PMID: 25518859]): 86-91https://doi.org/10.1017/thg.2014.79
        • Soave D.
        • Corvol H.
        • Panjwani N.
        • Gong J.
        • Li W.
        • Boelle P.Y.
        • et al.
        A joint location-scale test improves power to detect associated SNPs, gene sets, and pathways.
        Am J Hum Genet. 2015; 97 ([PubMed PMID: 26140448; PubMed Central PMCID: PMCPMC4572492]): 125-138https://doi.org/10.1016/j.ajhg.2015.05.015
        • Lie P.P.
        • Cheng C.Y.
        • Mruk D.D.
        The biology of interleukin-1: emerging concepts in the regulation of the actin cytoskeleton and cell junction dynamics.
        Cell Mol Life Sci. 2012; 69 ([PubMed PMID: 21744066; PubMed Central PMCID: PMCPMC3297025]): 487-500https://doi.org/10.1007/s00018-011-0760-0
        • Baum B.
        • Georgiou M.
        Dynamics of adherens junctions in epithelial establishment, maintenance, and remodeling.
        J Cell Biol. 2011; 192 ([PubMed PMID: 21422226; PubMed Central PMCID: PMCPMC3063136]): 907-917https://doi.org/10.1083/jcb.201009141
        • Bhowmick N.A.
        • Ghiassi M.
        • Bakin A.
        • Aakre M.
        • Lundquist C.A.
        • Engel M.E.
        • et al.
        Transforming growth factor-beta1 mediates epithelial to mesenchymal transdifferentiation through a RhoA-dependent mechanism.
        Mol Biol Cell. 2001; 12 ([PubMed PMID: 11160820; PubMed Central PMCID: PMCPMC30565]): 27-36
        • Kasai H.
        • Allen J.T.
        • Mason R.M.
        • Kamimura T.
        • Zhang Z.
        TGF-beta1 induces human alveolar epithelial to mesenchymal cell transition (EMT).
        Respir Res. 2005; 6 ([PubMed PMID: 15946381; PubMed Central PMCID: PMCPMC1177991]): 56https://doi.org/10.1186/1465-9921-6-56
        • Jiang Z.
        • Lao T.
        • Qiu W.
        • Polverino F.
        • Gupta K.
        • Guo F.
        • et al.
        A chronic obstructive pulmonary disease susceptibility gene, FAM13A, regulates protein stability of beta-catenin.
        Am J Respir Crit Care Med. 2016; 194 ([PubMed PMID: 26862784]): 185-197https://doi.org/10.1164/rccm.201505-0999OC
        • Jin Z.
        • Chung J.W.
        • Mei W.
        • Strack S.
        • He C.
        • Lau G.W.
        • et al.
        Regulation of nuclear-cytoplasmic shuttling and function of family with sequence similarity 13, member A (Fam13a), by B56-containing PP2As and Akt.
        Mol Biol Cell. 2015; 26 ([PubMed PMID: 25609086; PubMed Central PMCID: PMCPMC4357514]): 1160-1173https://doi.org/10.1091/mbc.E14-08-1276
        • Miller S.
        • Melen E.
        • Merid S.K.
        • Hall I.P.
        • Sayers I.
        Genes associated with polymorphic variants predicting lung function are differentially expressed during human lung development.
        Respir Res. 2016; 17 ([PubMed PMID: 27473260; PubMed Central PMCID: PMCPMC4966770]): 95https://doi.org/10.1186/s12931-016-0410-z
        • Mathew S.J.
        • Haubert D.
        • Kronke M.
        • Leptin M.
        Looking beyond death: a morphogenetic role for the TNF signalling pathway.
        J Cell Sci. 2009; 122 ([PubMed PMID: 19494121]): 1939-1946https://doi.org/10.1242/jcs.044487
        • Doerner A.M.
        • Zuraw B.L.
        TGF-beta1 induced epithelial to mesenchymal transition (EMT) in human bronchial epithelial cells is enhanced by IL-1beta but not abrogated by corticosteroids.
        Respir Res. 2009; 10 ([PubMed PMID: 19857272; PubMed Central PMCID: PMCPMC2774671]): 100https://doi.org/10.1186/1465-9921-10-100
        • Vandivier R.W.
        • Richens T.R.
        • Horstmann S.A.
        • deCathelineau A.M.
        • Ghosh M.
        • Reynolds S.D.
        • et al.
        Dysfunctional cystic fibrosis transmembrane conductance regulator inhibits phagocytosis of apoptotic cells with proinflammatory consequences.
        Am J Phys Lung Cell Mol Phys. 2009; 297 ([PubMed PMID: 19633071; PubMed Central PMCID: PMCPMC2770781]): L677-86https://doi.org/10.1152/ajplung.00030.2009
        • Wright J.M.
        • Merlo C.A.
        • Reynolds J.B.
        • Zei'tlin P.L.
        • Garcia J.G.
        • Guggino W.B.
        • et al.
        Respiratory epithelial gene expression in patients with mild and severe cystic fibrosis lung disease.
        Am J Respir Cell Mol Biol. 2006; 35 ([PubMed PMID: 16614352; PubMed Central PMCID: PMCPMC2643286]): 327-336https://doi.org/10.1165/rcmb.2005-0359OC
        • Ogilvie V.
        • Passmore M.
        • Hyndman L.
        • Jones L.
        • Stevenson B.
        • Wilson A.
        • et al.
        Differential global gene expression in cystic fibrosis nasal and bronchial epithelium.
        Genomics. 2011; 98 ([PubMed PMID: 21756994]): 327-336https://doi.org/10.1016/j.ygeno.2011.06.008
        • Sagel S.D.
        • Wagner B.D.
        • Anthony M.M.
        • Emmett P.
        • Zemanick E.T.
        Sputum biomarkers of inflammation and lung function decline in children with cystic fibrosis.
        Am J Respir Crit Care Med. 2012; 186 ([PubMed PMID: 22904182; PubMed Central PMCID: PMCPMC3530222]): 857-865https://doi.org/10.1164/rccm.201203-0507OC
        • Ganter M.T.
        • Roux J.
        • Miyazawa B.
        • Howard M.
        • Frank J.A.
        • Su G.
        • et al.
        Interleukin-1beta causes acute lung injury via alphavbeta5 and alphavbeta6 integrin-dependent mechanisms.
        Circ Res. 2008; 102 ([PubMed PMID: 18276918; PubMed Central PMCID: PMCPMC2739091]): 804-812https://doi.org/10.1161/CIRCRESAHA.107.161067
        • Farinha C.M.
        • Matos P.
        • Amaral M.D.
        Control of cystic fibrosis transmembrane conductance regulator membrane trafficking: not just from the endoplasmic reticulum to the Golgi.
        FEBS J. 2013; 280 ([PubMed PMID: 23773658]): 4396-4406https://doi.org/10.1111/febs.12392
        • Cantiello H.F.
        Role of actin filament organization in CFTR activation.
        Pflugers Arch. 2001; 443 ([PubMed PMID: 11845308]): S75-80https://doi.org/10.1007/s004240100649
        • Harris W.T.
        • Muhlebach M.S.
        • Oster R.A.
        • Knowles M.R.
        • Clancy J.P.
        • Noah T.L.
        Plasma TGF-beta(1) in pediatric cystic fibrosis: potential biomarker of lung disease and response to therapy.
        Pediatr Pulmonol. 2011; 46 ([PubMed PMID: 21337732; PubMed Central PMCID: PMCPMC3115503]): 688-695https://doi.org/10.1002/ppul.21430
        • Dorfman R.
        • Sandford A.
        • Taylor C.
        • Huang B.
        • Frangolias D.
        • Wang Y.
        • et al.
        Complex two-gene modulation of lung disease severity in children with cystic fibrosis.
        J Clin Invest. 2008; 118 ([PubMed PMID: 18292811; PubMed Central PMCID: PMCPMC2248329]): 1040-1049https://doi.org/10.1172/JCI33754
        • Eisenhut F.
        • Heim L.
        • Trump S.
        • Mittler S.
        • Sopel N.
        • Andreev K.
        • et al.
        FAM13A is associated with non-small cell lung cancer (NSCLC) progression and controls tumor cell proliferation and survival.
        Oncoimmunology. 2017; 6 ([PubMed PMID: 28197372; PubMed Central PMCID: PMCPMC5283630])e1256526https://doi.org/10.1080/2162402X.2016.1256526
        • Clarke L.A.
        • Botelho H.M.
        • Sousa L.
        • Falcao A.O.
        • Amaral M.D.
        Transcriptome meta-analysis reveals common differential and global gene expression profiles in cystic fibrosis and other respiratory disorders and identifies CFTR regulators.
        Genomics. 2015; 106 ([PubMed PMID: 26225835]): 268-277https://doi.org/10.1016/j.ygeno.2015.07.005
        • Bartis D.
        • Mise N.
        • Mahida R.Y.
        • Eickelberg O.
        • Thickett D.R.
        Epithelial-mesenchymal transition in lung development and disease: does it exist and is it important?.
        Thorax. 2014; 69 ([PubMed PMID: 24334519]): 760-765https://doi.org/10.1136/thoraxjnl-2013-204608
        • Pain M.
        • Bermudez O.
        • Lacoste P.
        • Royer P.J.
        • Botturi K.
        • Tissot A.
        • et al.
        Tissue remodelling in chronic bronchial diseases: from the epithelial to mesenchymal phenotype.
        Eur Respir Rev. 2014; 23 ([PubMed PMID: 24591669]): 118-130https://doi.org/10.1183/09059180.00004413
        • Plotkowski M.C.
        • de Bentzmann S.
        • Pereira S.H.
        • Zahm J.M.
        • Bajolet-Laudinat O.
        • Roger P.
        • et al.
        Pseudomonas aeruginosa internalization by human epithelial respiratory cells depends on cell differentiation, polarity, and junctional complex integrity.
        Am J Respir Cell Mol Biol. 1999; 20 ([PubMed PMID: 10226058]): 880-890https://doi.org/10.1165/ajrcmb.20.5.3408
        • Soong G.
        • Martin F.J.
        • Chun J.
        • Cohen T.S.
        • Ahn D.S.
        • Prince A.
        Staphylococcus aureus protein A mediates invasion across airway epithelial cells through activation of RhoA GTPase signaling and proteolytic activity.
        J Biol Chem. 2011; 286 ([PubMed PMID: 21878647; PubMed Central PMCID: PMCPMC3195615]): 35891-35898https://doi.org/10.1074/jbc.M111.295386
        • Ferru-Clement R.
        • Fresquet F.
        • Norez C.
        • Metaye T.
        • Becq F.
        • Kitzis A.
        • et al.
        Involvement of the Cdc42 pathway in CFTR post-translational turnover and in its plasma membrane stability in airway epithelial cells.
        PLoS One. 2015; 10 ([PubMed PMID: 25768293; PubMed Central PMCID: PMCPMC4359135])e0118943https://doi.org/10.1371/journal.pone.0118943
        • van der Plaat D.A.
        • de Jong K.
        • Lahousse L.
        • Faiz A.
        • Vonk J.M.
        • van Diemen C.C.
        • et al.
        Genome-wide association study on the FEV1/FVC ratio in never-smokers identifies HHIP and FAM13A.
        J Allergy Clin Immunol. 2017; 139 ([PubMed PMID: 27612410]): 533-540https://doi.org/10.1016/j.jaci.2016.06.062
        • Cohen J.C.
        • Larson J.E.
        • Killeen E.
        • Love D.
        • Takemaru K.
        CFTR and Wnt/beta-catenin signaling in lung development.
        BMC Dev Biol. 2008; 8 ([PubMed PMID: 18601749; PubMed Central PMCID: PMCPMC2464600]): 70https://doi.org/10.1186/1471-213X-8-70
        • Liu K.
        • Zhang X.
        • Zhang J.T.
        • Tsang L.L.
        • Jiang X.
        • Chan H.C.
        Defective CFTR- beta-catenin interaction promotes NF-kappaB nuclear translocation and intestinal inflammation in cystic fibrosis.
        Oncotarget. 2016; ([PubMed PMID: 27588407])https://doi.org/10.18632/oncotarget.11747